Engineering RNA-based tools to probe and manipulate biological systems
RNA imaging: A tale of two G-quadruplexes (News and Views) Aaron E. Engelhart Nature Chemical Biology, 2017. doi:10.1038/nchembio.2492 Publisher | ResearchGate | PubMed | Google Scholar | Free Readcube Link to Paper This News and Views piece from our lab accompanies the the publication of […]
Pack and Give Back Spinach 24-2: GACGCAACUGAAUGAAAUGGUGAAGGACGGGUCCAGGUGUGGCUGCUUCG GCAGUGCAGCUUGUUGAGUAGAGUGUGAGCUCCGUAACUAGUCGCGUC Mfold Pymol: pymolfiles
Congratulations to Prof. Engelhart for being announced as the winner of the Stanley L. Miller Early Career Award at the 2017 meeting of the International Society for the Study of the Origin of Life in San Diego, CA! The University of Minnesota College of Biological […]
Congratulations to Nathaniel Gaut for being awarded a travel grant to present his research at SB7.0 – the Seventh International Meeting on Synthetic Biology in Singapore!
Prof. Engelhart was interviewed, along with UMN collaborator Prof. Kate Adamala, for Minnesota Public Radio’s Brains On! podcast and radio show about the first life on earth.
Congratulations to Dr. Jose Gomez-Garcia for winning the second place poster award in the CBS Postdoc Symposium!
Fun with Nucleic Acids Introductory organic chemistry has sent many a pre-med scurrying toward an alternative career. And that’s exactly what it did for Aaron Engelhart — but not for the usual reason, and not in the usual direction. Instead of steering him away from […]
Postdoctoral Positions in the Engelhart Lab at the University of Minnesota Our laboratory studies nucleic acids, both as targets of basic research and tools to study complex biological systems. A few projects our lab is currently working on are given below: RNA imaging: GFP and […]
Processed Data from Itasca Module Graphs: Itasca Module – Graphs of Results (PDF) Excel Files: Itasca Module – AM Results (Excel) Itasca Module – PM Results (Excel) Igor files: Itasca Module – Igor Files AM and PM (ZIP) Link to Igor Pro trial download Graphs […]
Collaboration between primitive cell membranes and soluble catalysts Katarzyna P. Adamala, Aaron E. Engelhart (joint first author), and Jack W. Szostak Nature Communications, 2016. doi:10.1038/ncomms11041 Publisher | ResearchGate | PubMed | Google Scholar Scientific Abstract One widely held model of early life suggests primitive cells […]