Novel COVID-19 vaccines and some diagnostic tests use messenger ribonucleic acid (mRNA). Aaron Engelhart investigates ways to track the nucleic acid. CBS Website writeup on vaccines and diagnostics https://cbs.umn.edu/blogs/cbs-connect/decoding-rna%E2%80%99s-mysteries
Author: Aaron Engelhart
A new era for vaccines? A Petri Dish conversation
Aaron Engelhart will participate in the Petri Dish event panel. https://www.eventbrite.com/e/a-new-era-for-vaccines-a-petri-dish-conversation-registration-136961642961 Wed, February 17, 2021 4:00 PM – 5:30 PM CST Join for a lively conversation about new approaches to fighting disease. It seems like the pandemic made everyone a medical expert as we latched […]
Nathaniel Gaut Wins 2nd Place in UMN 3 Minute Thesis Award Competition!
Congratulations Nate!
Preparation, Purification, and Use of Fatty Acid-containing Liposomes (Journal of Visualized Experiments 2018)
Preparation, Purification, and Use of Fatty Acid-containing Liposomes (News and Views) Aaron E. Engelhart Journal of Visualized Experiments, 2018. doi:10.3791/57324 Publisher | ResearchGate | PubMed | Google Scholar | Free Readcube Link to Paper Liposomes containing single-chain amphiphiles, particularly fatty acids, exhibit distinct properties compared […]
RNA imaging: A tale of two G-quadruplexes (Nature Chemical Biology 2017) (News and Views)
RNA imaging: A tale of two G-quadruplexes (News and Views) Aaron E. Engelhart Nature Chemical Biology, 2017. doi:10.1038/nchembio.2492 Publisher | ResearchGate | PubMed | Google Scholar | Free Readcube Link to Paper This News and Views piece from our lab accompanies the the publication of […]
Itasca Module Information
Pack and Give Back Spinach 24-2: GACGCAACUGAAUGAAAUGGUGAAGGACGGGUCCAGGUGUGGCUGCUUCG GCAGUGCAGCUUGUUGAGUAGAGUGUGAGCUCCGUAACUAGUCGCGUC Mfold Pymol: pymolfiles
Prof. Engelhart wins Stanley L. Miller Early Career Award!
Congratulations to Prof. Engelhart for being announced as the winner of the Stanley L. Miller Early Career Award at the 2017 meeting of the International Society for the Study of the Origin of Life in San Diego, CA! The University of Minnesota College of Biological […]
Nathaniel Gaut awarded travel grant to SB7.0 in Singapore!
Congratulations to Nathaniel Gaut for being awarded a travel grant to present his research at SB7.0 – the Seventh International Meeting on Synthetic Biology in Singapore!
Prof. Engelhart interviewed by MPR
Prof. Engelhart was interviewed, along with UMN collaborator Prof. Kate Adamala, for Minnesota Public Radio’s Brains On! podcast and radio show about the first life on earth.
Dr. Jose Gomez-Garcia wins poster prize!
Congratulations to Dr. Jose Gomez-Garcia for winning the second place poster award in the CBS Postdoc Symposium!