RNA imaging: A tale of two G-quadruplexes (News and Views) Aaron E. Engelhart Nature Chemical Biology, 2017. doi:10.1038/nchembio.2492 Publisher | Res...
Read More
Pack and Give Back Spinach 24-2: GACGCAACUGAAUGAAAUGGUGAAGGACGGGUCCAGGUGUGGCUGCUUCG GCAGUGCAGCUUGUUGAGUAGAGUGUGAGCUCCGUAACUAGUCGCGUC Mfold Pymo...
Read MoreItasca Module Information
Congratulations to Prof. Engelhart for being announced as the winner of the Stanley L. Miller Early Career Award at the 2017 meeting of the Internatio...
Read MoreProf. Engelhart wins Stanley L. Miller Early Career Award!
Congratulations to Nathaniel Gaut for being awarded a travel grant to present his research at SB7.0 – the Seventh International Meeting on Synth...
Read MoreNathaniel Gaut awarded travel grant to SB7.0 in Singapore!
Prof. Engelhart was interviewed, along with UMN collaborator Prof. Kate Adamala, for Minnesota Public Radio’s Brains On! podcast and radio show ...
Read MoreProf. Engelhart interviewed by MPR
Congratulations to Dr. Jose Gomez-Garcia for winning the second place poster award in the CBS Postdoc Symposium!...
Read MoreDr. Jose Gomez-Garcia wins poster prize!
Fun with Nucleic Acids Introductory organic chemistry has sent many a pre-med scurrying toward an alternative career. And that’s exactly what it did...
Read MoreUniversity of Minnesota College of Biological Sciences Profiles Engelhart Lab Research
Postdoctoral Positions in the Engelhart Lab at the University of Minnesota Our laboratory studies nucleic acids, both as targets of basic research and...
Read MorePostdoctoral Positions Available
Processed Data from Itasca Module Graphs: Itasca Module – Graphs of Results (PDF) Excel Files: Itasca Module – AM Results (Excel) Itasca M...
Read MoreItasca Information
Collaboration between primitive cell membranes and soluble catalysts Katarzyna P. Adamala, Aaron E. Engelhart (joint first author), and Jack W. Szosta...
Read More